Sample ID: KDD0161
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:01 |
| Analysis completed | 2025-05-03 01:28:01 |
| Wall time | 0:0:0 hours |
Tetranychus marianae
Outcome: Positive species identification.
Reasoning: [Flag 1A] 1 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | True |
|
Flag 7A: Identified species is consistent with preliminary morphology ID Tetranychus. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
| Coverage of Tetranychus | |
| Coverage of species in genus Tetranychus | |
| Coverage of species in genus Tetranychus in country of origin Australia |
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 696 sequences in the reference database for Tetranychus at the given locus COI.
Global occurrence records for Tetranychus.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2B:
The reference data offers some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
Reasoning: Not all species in genus from the country of origin have reference sequence(s) for this locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI
| Taxa of interest detected? | True |
|
Flag 2A: Taxon of interest detected in candidate species Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2B: 10-90% of related taxa have reference sequence(s) at the given locus |
|
| Locus | COI |
| Preliminary ID | Tetranychus |
| Taxa of interest |
Tetranychus |
| Country | Australia |
| Host | Aibika |
| Sample ID | KDD0161 |
| Query DNA sequence |
>KDD0161 AAAAGATATTGGTACTATATATTTTTTATTTAGTTTATTTTCAGGTTTAATAGGAACTTC AATAAGAATAATTATTCGAATAGAATTAATAACACCAGGATCACTAATTCAAAATGATTT TATTTATAATTCTTTAGTTACCACTCATGCTATAATTATAATCTTTTTTATAGTTATACC CGCTATAATTGGAGGATTTGGAAATTGATTAATTCCTATAATAATTAACAGTCCAGATTT ATGTTTTCCACGAATTAATAATATAAGATTTTGATTACTTTTACCTTCACTATTACTTAT AATAAGAGCATCTATAAAAAGTGTAATAAACGGAGTAGGATGAACAATATATCCCCCACT AACTTCTATTCAATATTTTATATCTTCGTCCATTGAAATGATAATTTTTTCTCTTCATAT TGCAGGTATTTCCTCTATTGCAAGATCAATTAATTTTATTTCAACTATTATATTAATAAA AAATAAAAACTACATTATAAGAAATTTAACACTATTTACTTTATCAATTTTAATTACAAC TTTTTTATTACTATTAGCTTTACCTGTATTAGCAGGTGCTATTACAATAATTTTAATAGA CCGAAATTTTAATACCTCTTTTTTTGATCCTAGCGGAGGAGGAGATCNAATTTTATATCA ACATCTATTCTGATTTTTTGG
Flag 1A:
Positive species identification
-
Tetranychus marianae
1 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 6 | 1 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Tetranychus marianae | 6 | 98.9% | 0.0 |
Database coverage of Candidate Tetranychus marianaeThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Tetranychus marianae
Flag 5.1C:
The reference data are likely to be unreliable for this species
1 records
There are 1 sequences in the reference database for Tetranychus marianae at the given locus COI.
Global occurrence records for Tetranychus marianae.
Database coverage of species in genus Tetranychus
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Tetranychus that occur in country of origin Australia
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | MW326470 | Tetranychus marianae voucher FSCA2019_1653 (2F) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 446 | 65.5% | 846.918 | 0.00e+00 | 98.9% |
| 2 | MW326471 | Tetranychus marianae voucher FSCA2019_1653 (3F) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 446 | 65.5% | 846.918 | 0.00e+00 | 98.9% |
| 3 | MW326472 | Tetranychus marianae voucher FSCA2019_1653 (4F) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 446 | 65.5% | 846.918 | 0.00e+00 | 98.9% |
| 4 | OP703558 | Tetranychus marianae isolate Cma1Kdl1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 440 | 64.6% | 835.025 | 0.00e+00 | 98.9% |
| 5 | MW326473 | Tetranychus marianae voucher FSCA2019_1653 (5F) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 416 | 61.1% | 787.45 | 0.00e+00 | 98.8% |
| 6 | MW672202 | Tetranychus marianae voucher FSCA2019_1653 (6F) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 410 | 60.2% | 775.557 | 0.00e+00 | 98.8% |
| 7 | PP188568 | Tetranychus truncatus isolate Cha1Agr1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 356 | 52.3% | 414.785 | 7.66e-111 | 89.6% |
| 8 | AB736074 | Tetranychus truncatus mitochondrial cox1 gene for cytochrome oxidase subunit I, partial cds, strain: Ttr0196 | 338 | 49.6% | 387.033 | 1.73e-102 | 89.4% |
| 9 | AB257315 | Tetranychus truncatus mitochondrial cox1 gene for cytochrome oxidase subunit I, partial cds, isolate: #050729_05 | 333 | 48.9% | 377.122 | 1.67e-99 | 89.2% |
| 10 | AB736071 | Tetranychus pueraricola mitochondrial cox1 gene for cytochrome oxidase subunit I, partial cds, strain: Tpu0203 | 335 | 49.2% | 365.228 | 6.34e-96 | 88.7% |
| 11 | KR260201 | Tetranychus truncatus voucher VCu1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 368 | 54.0% | 390.998 | 1.11e-103 | 88.3% |
| 12 | MG518347 | Tetranychus truncatus haplotype Tt22 mitochondrion, complete genome | 681 | 100.0% | 700.231 | 0.00e+00 | 88.0% |
| 13 | MG518350 | Tetranychus truncatus haplotype Tt1 mitochondrion, complete genome | 681 | 100.0% | 700.231 | 0.00e+00 | 88.0% |
| 14 | MG518349 | Tetranychus truncatus haplotype Tt2 mitochondrion, complete genome | 681 | 100.0% | 700.231 | 0.00e+00 | 88.0% |
| 15 | MG317556 | Tetranychidae sp. BIOUG22881-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.1% | 654.639 | 0.00e+00 | 88.0% |
| 16 | KM832676 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 92.7% | 648.692 | 0.00e+00 | 88.0% |
| 17 | OP760197 | Tetranychus truncatus isolate Bnj7Vka2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 460.377 | 1.44e-124 | 88.0% |
| 18 | KX281703 | Tetranychus lambi voucher ww26531 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 424 | 62.3% | 438.572 | 5.29e-118 | 88.0% |
| 19 | KX281704 | Tetranychus lambi voucher ww26532 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 424 | 62.3% | 438.572 | 5.29e-118 | 88.0% |
| 20 | KX281699 | Tetranychus lambi voucher ww26530 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 424 | 62.3% | 438.572 | 5.29e-118 | 88.0% |
| 21 | KU516064 | Tetranychus pueraricola haplotype J cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 383.069 | 2.70e-101 | 88.0% |
| 22 | PQ223435 | Tetranychus urticae voucher CA1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 680 | 99.9% | 700.231 | 0.00e+00 | 87.9% |
| 23 | MG518345 | Tetranychus truncatus haplotype Tt8 mitochondrion, complete genome | 681 | 100.0% | 692.302 | 0.00e+00 | 87.9% |
| 24 | MG518346 | Tetranychus truncatus haplotype Tt7 mitochondrion, complete genome | 681 | 100.0% | 692.302 | 0.00e+00 | 87.9% |
| 25 | MG518348 | Tetranychus truncatus haplotype Tt3 mitochondrion, complete genome | 681 | 100.0% | 692.302 | 0.00e+00 | 87.9% |
| 26 | KM829308 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 92.4% | 644.728 | 4.62e-180 | 87.9% |
| 27 | MG518352 | Tetranychus pueraricola haplotype TP10. mitochondrion, complete genome | 681 | 100.0% | 692.302 | 0.00e+00 | 87.8% |
| 28 | MG518351 | Tetranychus truncatus haplotype Tt4 mitochondrion, complete genome | 681 | 100.0% | 692.302 | 0.00e+00 | 87.8% |
| 29 | OQ438696 | Tetranychus truncatus isolate Pusa-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 680 | 99.9% | 692.302 | 0.00e+00 | 87.8% |
| 30 | JX075251 | Tetranychus neocaledonicus cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 95.0% | 658.603 | 0.00e+00 | 87.8% |
| 31 | KM825981 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 92.7% | 640.763 | 7.21e-179 | 87.8% |
| 32 | MK627523 | Tetranychus truncatus voucher UAS-B:2414A cytochrome c oxidase subunit I (CO1) gene, partial cds; mitochondrial | 561 | 82.4% | 567.419 | 8.64e-157 | 87.8% |
| 33 | OP741013 | Tetranychus truncatus isolate Agd1Vka1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 452.448 | 3.52e-122 | 87.8% |
| 34 | OP622878 | Tetranychus truncatus isolate Ban7End3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 452.448 | 3.52e-122 | 87.8% |
| 35 | OP741141 | Tetranychus truncatus isolate Am12Alr2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 439 | 64.5% | 444.519 | 8.58e-120 | 87.8% |
| 36 | KU516059 | Tetranychus pueraricola haplotype E cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 375.14 | 6.59e-99 | 87.8% |
| 37 | KU516062 | Tetranychus pueraricola haplotype H cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 375.14 | 6.59e-99 | 87.8% |
| 38 | MG518344 | Tetranychus truncatus haplotype Tt5 mitochondrion, complete genome | 681 | 100.0% | 684.373 | 0.00e+00 | 87.7% |
| 39 | MG518336 | Tetranychus truncatus haplotype Tt29 mitochondrion, complete genome | 681 | 100.0% | 684.373 | 0.00e+00 | 87.7% |
| 40 | MG518331 | Tetranychus truncatus haplotype Tt28 mitochondrion, complete genome | 681 | 100.0% | 684.373 | 0.00e+00 | 87.7% |
| 41 | MN351508 | Tetranychus urticae voucher BIOUG36146-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 660.586 | 0.00e+00 | 87.7% |
| 42 | MN347250 | Tetranychus urticae voucher BIOUG36146-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 660.586 | 0.00e+00 | 87.7% |
| 43 | MN348791 | Tetranychus urticae voucher BIOUG36166-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 660.586 | 0.00e+00 | 87.7% |
| 44 | MN347496 | Tetranychus urticae voucher BIOUG36146-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 660.586 | 0.00e+00 | 87.7% |
| 45 | MN350737 | Tetranychus urticae voucher BIOUG36146-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 660.586 | 0.00e+00 | 87.7% |
| 46 | MN347589 | Tetranychus urticae voucher BIOUG36146-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 660.586 | 0.00e+00 | 87.7% |
| 47 | JX075250 | Tetranychus urticae cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 632 | 92.8% | 636.798 | 1.13e-177 | 87.7% |
| 48 | MK508722 | Tetranychus urticae strain GSS cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 632.834 | 1.76e-176 | 87.7% |
| 49 | MK508719 | Tetranychus urticae strain 8 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 632.834 | 1.76e-176 | 87.7% |
| 50 | MK508720 | Tetranychus urticae strain 9 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 632.834 | 1.76e-176 | 87.7% |
| 51 | MK508716 | Tetranychus urticae strain 5 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 632.834 | 1.76e-176 | 87.7% |
| 52 | MK508713 | Tetranychus urticae strain 2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 632.834 | 1.76e-176 | 87.7% |
| 53 | MK508718 | Tetranychus urticae strain 7 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 632.834 | 1.76e-176 | 87.7% |
| 54 | MK508717 | Tetranychus urticae strain 6 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 632.834 | 1.76e-176 | 87.7% |
| 55 | KM839328 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 630.852 | 6.94e-176 | 87.7% |
| 56 | KM834315 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 601 | 88.3% | 605.082 | 3.97e-168 | 87.7% |
| 57 | KM828007 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 601 | 88.3% | 605.082 | 3.97e-168 | 87.7% |
| 58 | KM829615 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 88.1% | 603.1 | 1.57e-167 | 87.7% |
| 59 | MG312255 | Tetranychus urticae voucher BIOUG31850-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 413 | 60.6% | 414.785 | 7.66e-111 | 87.7% |
| 60 | PP970364 | Schizotetranychus mansoni isolate Ric29Epl1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 383 | 56.2% | 389.016 | 4.38e-103 | 87.7% |
| 61 | KF447574 | Tetranychus urticae strain DeLier1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 680 | 99.9% | 684.373 | 0.00e+00 | 87.6% |
| 62 | PQ223437 | Tetranychus urticae voucher RE1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 680 | 99.9% | 684.373 | 0.00e+00 | 87.6% |
| 63 | MG518341 | Tetranychus truncatus haplotype Tt9 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 64 | MG518342 | Tetranychus truncatus haplotype Tt13 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 65 | MG518340 | Tetranychus truncatus haplotype Tt16 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 66 | MG518338 | Tetranychus truncatus haplotype Tt11 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 67 | MG518343 | Tetranychus truncatus haplotype Tt14 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 68 | MG518330 | Tetranychus truncatus haplotype Tt24 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 69 | MG518333 | Tetranychus truncatus haplotype Tt17. mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 70 | MG518328 | Tetranychus truncatus haplotype Tt27 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 71 | MG518329 | Tetranychus truncatus haplotype Tt25 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 72 | MG518337 | Tetranychus truncatus haplotype Tt12 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 73 | MG518332 | Tetranychus truncatus haplotype Tt20 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 74 | MG518327 | Tetranychus truncatus haplotype Tt26 mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 75 | NC_024874 | Tetranychus truncatus mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.6% |
| 76 | KM824070 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 92.7% | 632.834 | 1.76e-176 | 87.6% |
| 77 | KM825435 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 90.0% | 613.011 | 1.63e-170 | 87.6% |
| 78 | KM824874 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 90.0% | 613.011 | 1.63e-170 | 87.6% |
| 79 | KM828451 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 89.9% | 611.029 | 6.44e-170 | 87.6% |
| 80 | KM831442 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 89.7% | 609.047 | 2.54e-169 | 87.6% |
| 81 | KM835558 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 598 | 87.8% | 599.136 | 2.45e-166 | 87.6% |
| 82 | KM836322 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG08282-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 585.26 | 3.68e-162 | 87.6% |
| 83 | MF747466 | Tetranychidae sp. BIOUG06909-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 524 | 76.9% | 523.81 | 1.16e-143 | 87.6% |
| 84 | MG318683 | Tetranychus urticae voucher BIOUG09802-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 524 | 76.9% | 523.81 | 1.16e-143 | 87.6% |
| 85 | MG513286 | Tetranychus sp. BIOUG20818-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 476 | 69.9% | 478.217 | 6.15e-130 | 87.6% |
| 86 | KT208292 | Tetranychus truncatus voucher AnGA1COI cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 463 | 68.0% | 460.377 | 1.44e-124 | 87.6% |
| 87 | OP741019 | Tetranychus truncatus isolate Bnj8Ayr1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 460.377 | 1.44e-124 | 87.6% |
| 88 | MF774635 | Tetranychus truncatus isolate PmMK0927 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 433 | 63.6% | 432.625 | 3.26e-116 | 87.6% |
| 89 | KX669023 | Tetranychus truncatus voucher UAS-B:20062016 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 90 | KR297226 | Tetranychus truncatus isolate EC1 cytochrome oxidase sununit I (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 91 | MF774633 | Tetranychus truncatus isolate CpVk19116 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 92 | KR271023 | Tetranychus truncatus voucher ACCOI cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 93 | MF774634 | Tetranychus truncatus isolate BaKo1037 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 94 | KR271024 | Tetranychus truncatus voucher AC3 Nov COI cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 95 | MF774630 | Tetranychus truncatus isolate TpOk12126 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 96 | KR733110 | Tetranychus truncatus cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 97 | KR052245 | Tetranychus truncatus isolate VA1.2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 431 | 63.3% | 428.661 | 5.10e-115 | 87.6% |
| 98 | OR900425 | Tetranychus urticae mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.5% |
| 99 | OR906292 | Tetranychus urticae strain Cudgewa mitochondrion, complete genome | 681 | 100.0% | 676.444 | 0.00e+00 | 87.5% |
| 100 | KY922440 | Tetranychus urticae voucher UMMZ BMOC 07-0815-020 AD1014 cytochrome oxidase subunit I (COXI) gene, partial cds; mitochondrial | 673 | 98.8% | 670.497 | 0.00e+00 | 87.5% |
| 101 | KY922439 | Eotetranychus sp. AD1954 voucher UMMZ BMOC 14-0630-046 AD1954 cytochrome oxidase subunit I (COXI) gene, partial cds; mitochondrial | 673 | 98.8% | 670.497 | 0.00e+00 | 87.5% |
| 102 | MG319470 | Tetranychus urticae voucher BIOUG09632-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 652.657 | 0.00e+00 | 87.5% |
| 103 | MN349781 | Tetranychus urticae voucher BIOUG36146-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 652.657 | 0.00e+00 | 87.5% |
| 104 | MG320025 | Tetranychus urticae voucher BIOUG08672-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 652.657 | 0.00e+00 | 87.5% |
| 105 | MH983804 | Tetranychus urticae voucher MZNA442801 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 655 | 96.2% | 650.674 | 0.00e+00 | 87.5% |
| 106 | JX075249 | Tetranychus truncatus cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 644 | 94.6% | 636.798 | 1.13e-177 | 87.5% |
| 107 | MN398269 | Tetranychus urticae isolate PK13 cytochrome oxidase I subunit I gene, partial cds; mitochondrial | 632 | 92.8% | 628.869 | 2.74e-175 | 87.5% |
| 108 | KM836726 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.4% | 599.136 | 2.45e-166 | 87.5% |
| 109 | KM827299 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.4% | 599.136 | 2.45e-166 | 87.5% |
| 110 | KM827047 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 601 | 88.3% | 597.153 | 9.68e-166 | 87.5% |
| 111 | KM828465 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 599 | 88.0% | 593.189 | 1.51e-164 | 87.5% |
| 112 | MT814057 | Tetranychus urticae isolate 15CAS9b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 113 | MT814093 | Tetranychus urticae isolate 17MEY6b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 114 | MT814091 | Tetranychus urticae isolate 17MEY13b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 115 | MT814056 | Tetranychus urticae isolate 15CAS13a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 116 | MT814088 | Tetranychus urticae isolate 16MEY12a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 117 | MT814090 | Tetranychus urticae isolate 16MEY7a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 118 | MT814085 | Tetranychus urticae isolate 15MEY12c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 119 | MT814087 | Tetranychus urticae isolate 15MEY6c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 120 | MT814089 | Tetranychus urticae isolate 16MEY16 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 121 | MT814086 | Tetranychus urticae isolate 15MEY16b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 122 | MT814092 | Tetranychus urticae isolate 17MEY16c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 585.26 | 3.68e-162 | 87.5% |
| 123 | MT814207 | Tetranychus urticae isolate 15MEY5c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 583.277 | 1.46e-161 | 87.5% |
| 124 | MT814209 | Tetranychus urticae isolate 17MEY3d cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 583.277 | 1.46e-161 | 87.5% |
| 125 | MT814206 | Tetranychus urticae isolate 15MEY4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 583.277 | 1.46e-161 | 87.5% |
| 126 | MT814208 | Tetranychus urticae isolate 16MEY3e cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 583.277 | 1.46e-161 | 87.5% |
| 127 | MT814210 | Tetranychus urticae isolate 17MEY4c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 583.277 | 1.46e-161 | 87.5% |
| 128 | OP363220 | Tetranychus truncatus isolate Am3Amb1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 430 | 63.1% | 426.679 | 2.01e-114 | 87.5% |
| 129 | OP355286 | Tetranychus truncatus isolate Cu2Vka2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 430 | 63.1% | 426.679 | 2.01e-114 | 87.5% |
| 130 | OP363222 | Tetranychus truncatus isolate Chm1Vka1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 430 | 63.1% | 426.679 | 2.01e-114 | 87.5% |
| 131 | MF774632 | Tetranychus truncatus isolate TpMk29116 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 429 | 63.0% | 424.696 | 7.95e-114 | 87.5% |
| 132 | KU516063 | Tetranychus pueraricola haplotype I cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 367.211 | 1.61e-96 | 87.5% |
| 133 | KU516061 | Tetranychus pueraricola haplotype G cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 367.211 | 1.61e-96 | 87.5% |
| 134 | KU516068 | Tetranychus pueraricola haplogroup N cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 367.211 | 1.61e-96 | 87.5% |
| 135 | KU516067 | Tetranychus pueraricola haplogroup M cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 367.211 | 1.61e-96 | 87.5% |
| 136 | KU516069 | Tetranychus pueraricola haplotype O cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 367.211 | 1.61e-96 | 87.5% |
| 137 | KU516070 | Tetranychus pueraricola haplotype P cytochrome oxidase subunit I (cox1) gene, partial cds; mitochondrial | 368 | 54.0% | 367.211 | 1.61e-96 | 87.5% |
| 138 | LC219377 | Dioscorea rotundata mitochondrial DNA, contig: TDr_Mt_scaffold4_size13096, cultivar: TDr96_F1 | 681 | 100.0% | 668.515 | 0.00e+00 | 87.4% |
| 139 | MG518339 | Tetranychus truncatus haplotype Tt15 mitochondrion, complete genome | 681 | 100.0% | 668.515 | 0.00e+00 | 87.4% |
| 140 | KJ729022 | Tetranychus urticae mitochondrion, complete genome | 681 | 100.0% | 668.515 | 0.00e+00 | 87.4% |
| 141 | MG518326 | Tetranychus truncatus haplotype Tt23 mitochondrion, complete genome | 681 | 100.0% | 668.515 | 0.00e+00 | 87.4% |
| 142 | MG518359 | Tetranychus pueraricola haplotype TP6. mitochondrion, complete genome | 681 | 100.0% | 668.515 | 0.00e+00 | 87.4% |
| 143 | MG518334 | Tetranychus truncatus haplotype Tt18 mitochondrion, complete genome | 681 | 100.0% | 668.515 | 0.00e+00 | 87.4% |
| 144 | MG316426 | Tetranychus urticae voucher BIOUG09350-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.1% | 624.905 | 4.28e-174 | 87.4% |
| 145 | KM834300 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 90.0% | 605.082 | 3.97e-168 | 87.4% |
| 146 | KM824538 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 90.0% | 605.082 | 3.97e-168 | 87.4% |
| 147 | KM826276 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03960-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 89.9% | 603.1 | 1.57e-167 | 87.4% |
| 148 | KM840392 | Tetranychus sp. BOLD:ACF7523 voucher BIOUG03953-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 601 | 88.3% | 589.224 | 2.36e-163 | 87.4% |
| 149 | MG313377 | Tetranychidae sp. BIOUG07257-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 87.1% | 581.295 | 5.75e-161 | 87.4% |
| 150 | MN913385 | Tetranychus urticae voucher 4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 581 | 85.3% | 573.366 | 1.40e-158 | 87.4% |
| 151 | MG312911 | Tetranychus urticae voucher BIOUG32399-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 530 | 77.8% | 519.845 | 1.81e-142 | 87.4% |
| 152 | MG518335 | Tetranychus truncatus haplotype Tt19 mitochondrion, complete genome | 681 | 100.0% | 660.586 | 0.00e+00 | 87.3% |
| 153 | MG315961 | Tetranychus urticae voucher BIOUG09632-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 644.728 | 4.62e-180 | 87.3% |
| 154 | KC136132 | Tetranychus urticae voucher 20090525-2-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 644.728 | 4.62e-180 | 87.3% |
| 155 | MN353637 | Tetranychus urticae voucher BIOUG36146-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 644.728 | 4.62e-180 | 87.3% |
| 156 | MZ664299 | Tetranychus urticae isolate Tur_CO1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 96.3% | 644.728 | 4.62e-180 | 87.3% |
| 157 | MG315394 | Tetranychus urticae voucher BIOUG08419-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 644.728 | 4.62e-180 | 87.3% |
| 158 | MZ664298 | Tetranychus truncatus isolate Ttr_CO1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 96.5% | 638.781 | 2.85e-178 | 87.3% |
| 159 | PQ616018 | Tetranychus puschelii voucher SR4448 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 620 | 91.0% | 605.082 | 3.97e-168 | 87.3% |
| 160 | MN255802 | Tetranychus kanzawai voucher UAS-B:1890 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 615 | 90.3% | 603.1 | 1.57e-167 | 87.3% |
| 161 | MG315863 | Tetranychus sp. BIOUG01946-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 599 | 88.0% | 585.26 | 3.68e-162 | 87.3% |
| 162 | MT814135 | Tetranychus urticae isolate 17CAS21b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 163 | MT814106 | Tetranychus urticae isolate 15MEY11c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 164 | MT814059 | Tetranychus urticae isolate 17MEY9c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 165 | MT814096 | Tetranychus urticae isolate 15CAS11a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 166 | MT814099 | Tetranychus urticae isolate 15CAS14 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 167 | MT814151 | Tetranychus urticae isolate 17MEY6a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 168 | MT814131 | Tetranychus urticae isolate 17CAS17 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 169 | MT814121 | Tetranychus urticae isolate 16MEY11b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 170 | MT814152 | Tetranychus urticae isolate 17MEY7a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 171 | MT814124 | Tetranychus urticae isolate 16MEY3c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 172 | MT814146 | Tetranychus urticae isolate 17MEY17b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 173 | MT814153 | Tetranychus urticae isolate 17MEY8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 174 | MT814103 | Tetranychus urticae isolate 15CAS4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 175 | MT814104 | Tetranychus urticae isolate 15CAS5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 176 | MT814116 | Tetranychus urticae isolate 15MEY9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 177 | MT814119 | Tetranychus urticae isolate 16CAS9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 178 | MT814114 | Tetranychus urticae isolate 15MEY7a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 179 | MT814139 | Tetranychus urticae isolate 17CAS4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 180 | MT814055 | Tetranychus urticae isolate 15CAS11b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 181 | MT814100 | Tetranychus urticae isolate 15CAS17 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 182 | MT814149 | Tetranychus urticae isolate 17MEY3c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 183 | MT814134 | Tetranychus urticae isolate 17CAS2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 184 | MT814141 | Tetranychus urticae isolate 17CAS9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 185 | MT814143 | Tetranychus urticae isolate 17MEY12b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 186 | MT814129 | Tetranychus urticae isolate 17CAS12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 187 | MT814112 | Tetranychus urticae isolate 15MEY5b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 188 | MT814144 | Tetranychus urticae isolate 17MEY14c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 189 | MT814109 | Tetranychus urticae isolate 15MEY1a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 190 | MT814098 | Tetranychus urticae isolate 15CAS13b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 191 | MT814125 | Tetranychus urticae isolate 16MEY6b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 192 | MT814094 | Tetranychus urticae isolate 15CAS1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 193 | MT814148 | Tetranychus urticae isolate 17MEY2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 194 | MT814138 | Tetranychus urticae isolate 17CAS31 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 195 | MT814147 | Tetranychus urticae isolate 17MEY1b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 196 | MT814107 | Tetranychus urticae isolate 15MEY12b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 197 | MT814154 | Tetranychus urticae isolate 17MEY9b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 198 | MT814117 | Tetranychus urticae isolate 16CAS1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 199 | MT814110 | Tetranychus urticae isolate 15MEY2b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 200 | MT814126 | Tetranychus urticae isolate 16MEY8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 201 | MT814123 | Tetranychus urticae isolate 16MEY2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 202 | MT814102 | Tetranychus urticae isolate 15CAS19 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 203 | MT814113 | Tetranychus urticae isolate 15MEY6b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 204 | MT814133 | Tetranychus urticae isolate 17CAS19 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 205 | MT814132 | Tetranychus urticae isolate 17CAS18 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 206 | MT814122 | Tetranychus urticae isolate 16MEY12b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 207 | MT814105 | Tetranychus urticae isolate 15CAS9a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 208 | MT814150 | Tetranychus urticae isolate 17MEY4a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 209 | MT814115 | Tetranychus urticae isolate 15MEY8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 210 | MT814140 | Tetranychus urticae isolate 17CAS5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 211 | MT814097 | Tetranychus urticae isolate 15CAS12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 212 | MT814145 | Tetranychus urticae isolate 17MEY16d cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 213 | MT814142 | Tetranychus urticae isolate 17MEY11b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 214 | MT814095 | Tetranychus urticae isolate 15CAS10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 215 | MT814111 | Tetranychus urticae isolate 15MEY3b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 216 | MT814137 | Tetranychus urticae isolate 17CAS28 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 217 | MT814101 | Tetranychus urticae isolate 15CAS18 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 218 | MT814136 | Tetranychus urticae isolate 17CAS24 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 219 | MT814120 | Tetranychus urticae isolate 16MEY10b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 220 | MT814108 | Tetranychus urticae isolate 15MEY15b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 221 | MT814130 | Tetranychus urticae isolate 17CAS13 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 577.331 | 8.98e-160 | 87.3% |
| 222 | MT814118 | Tetranychus urticae isolate 16CAS2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 575.348 | 3.55e-159 | 87.3% |
| 223 | MT814127 | Tetranychus urticae isolate 16MEY9b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 575.348 | 3.55e-159 | 87.3% |
| 224 | MT814128 | Tetranychus urticae isolate 17CAS1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 575.348 | 3.55e-159 | 87.3% |
| 225 | MG310727 | Tetranychidae sp. BIOUG07257-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 584 | 85.8% | 571.384 | 5.54e-158 | 87.3% |
| 226 | MG317864 | Tetranychus urticae voucher BIOUG09632-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 527 | 77.4% | 513.898 | 1.12e-140 | 87.3% |
| 227 | KR072563 | Tetranychus truncatus cytochrome oxidase subunit I gene, partial cds; mitochondrial | 479 | 70.3% | 468.306 | 5.93e-127 | 87.3% |
| 228 | OR336315 | Tetranychus truncatus isolate ED46 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 452.448 | 3.52e-122 | 87.3% |
| 229 | OP704164 | Tetranychus truncatus isolate Bhn4Vka4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 452.448 | 3.52e-122 | 87.3% |
| 230 | OR336314 | Tetranychus truncatus isolate ED31 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 452.448 | 3.52e-122 | 87.3% |
| 231 | AF131108 | Tetranychus truncatus cytochrome oxidase subunit I gene, partial cds; mitochondrial gene for mitochondrial product | 463 | 68.0% | 452.448 | 3.52e-122 | 87.3% |
| 232 | MG518360 | Tetranychus pueraricola haplotype TP8. mitochondrion, complete genome | 681 | 100.0% | 660.586 | 0.00e+00 | 87.2% |
| 233 | KF447571 | Tetranychus urticae strain Santpoort2 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 680 | 99.9% | 660.586 | 0.00e+00 | 87.2% |
| 234 | MG518353 | Tetranychus pueraricola haplotype TP12. mitochondrion, complete genome | 681 | 100.0% | 660.586 | 0.00e+00 | 87.2% |
| 235 | MG318001 | Tetranychus urticae voucher BIOUG09633-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 236 | KC136133 | Tetranychus urticae voucher 20090525-2-2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 237 | MN351457 | Tetranychus urticae voucher BIOUG36146-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 238 | MG311905 | Tetranychus urticae voucher BIOUG09802-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 239 | MG316268 | Tetranychus urticae voucher BIOUG09803-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 240 | MG320024 | Tetranychus urticae voucher BIOUG09803-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 241 | MG320821 | Tetranychus urticae voucher BIOUG09130-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 242 | MZ664301 | Tetranychus pueraricola isolate Tpu_CO1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 243 | MG315106 | Tetranychus urticae voucher BIOUG08807-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 244 | MN535990 | Tetranychus urticae isolate Ros2vk cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 245 | MG317932 | Tetranychus urticae voucher BIOUG09632-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 246 | MG310881 | Tetranychus urticae voucher BIOUG09350-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 247 | MG319874 | Tetranychus urticae voucher BIOUG09130-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 636.798 | 1.13e-177 | 87.2% |
| 248 | OQ438702 | Tetranychus truncatus isolate Pusa-7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 624.905 | 4.28e-174 | 87.2% |
| 249 | MN351128 | Tetranychus sp. BIOUG30833-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 94.1% | 622.923 | 1.69e-173 | 87.2% |
| 250 | MN348303 | Tetranychus urticae voucher BIOUG31156-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 94.0% | 620.94 | 6.69e-173 | 87.2% |
| 251 | KF160881 | Tetranychus turkestani cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 626 | 91.9% | 607.065 | 1.01e-168 | 87.2% |
| 252 | MG313465 | Tetranychus urticae voucher BIOUG09632-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 75.6% | 498.04 | 6.64e-136 | 87.2% |
| 253 | MG512793 | Tetranychus pacificus voucher BIOUG07093-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 509 | 74.7% | 494.076 | 1.04e-134 | 87.2% |
| 254 | MG518358 | Tetranychus pueraricola haplotype TP4. mitochondrion, complete genome | 681 | 100.0% | 652.657 | 0.00e+00 | 87.1% |
| 255 | KJ729023 | Tetranychus urticae strain red mitochondrion, complete genome | 681 | 100.0% | 652.657 | 0.00e+00 | 87.1% |
| 256 | NC_024679 | Tetranychus phaselus mitochondrion, complete genome | 674 | 99.0% | 648.692 | 0.00e+00 | 87.1% |
| 257 | KX281695 | Tetranychus evansi voucher ww26526 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 628.869 | 2.74e-175 | 87.1% |
| 258 | MN351218 | Tetranychus sp. BIOUG30834-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 94.1% | 614.994 | 4.12e-171 | 87.1% |
| 259 | MT814155 | Tetranychus urticae isolate 15MEY10b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 569.402 | 2.19e-157 | 87.1% |
| 260 | MT814156 | Tetranychus urticae isolate 15MEY3c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 569.402 | 2.19e-157 | 87.1% |
| 261 | OL333561 | Tetranychus sp. isolate Bch cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 569.402 | 2.19e-157 | 87.1% |
| 262 | KM830639 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG06849-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 561.473 | 5.33e-155 | 87.1% |
| 263 | MG319924 | Tetranychidae sp. BIOUG07702-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 583 | 85.6% | 561.473 | 5.33e-155 | 87.1% |
| 264 | MG317001 | Tetranychus urticae voucher BIOUG31965-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 561.473 | 5.33e-155 | 87.1% |
| 265 | MG311432 | Tetranychus urticae voucher BIOUG31965-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 561.473 | 5.33e-155 | 87.1% |
| 266 | MF746957 | Tetranychidae sp. BIOUG19510-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 534 | 78.4% | 511.916 | 4.41e-140 | 87.1% |
| 267 | MG316754 | Tetranychus urticae voucher BIOUG32317-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 68.3% | 446.501 | 2.17e-120 | 87.1% |
| 268 | MG317222 | Tetranychus urticae voucher BIOUG09632-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 630.852 | 6.94e-176 | 87.0% |
| 269 | MG318555 | Tetranychidae sp. BIOUG07702-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 576 | 84.6% | 547.597 | 8.02e-151 | 87.0% |
| 270 | MG311728 | Tetranychus urticae voucher BIOUG31877-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 575 | 84.4% | 545.614 | 3.17e-150 | 87.0% |
| 271 | MG312829 | Tetranychus urticae voucher BIOUG32317-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 81.4% | 529.756 | 1.88e-145 | 87.0% |
| 272 | OP622880 | Tetranychus truncatus isolate Am10Vka5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 475 | 69.8% | 452.448 | 3.52e-122 | 87.0% |
| 273 | MT019793 | Tetranychus evansi isolate CO1_JT_Sample_8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 383 | 56.2% | 365.228 | 6.34e-96 | 87.0% |
| 274 | KF447576 | Tetranychus evansi strain Algarrobo1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 383 | 56.2% | 365.228 | 6.34e-96 | 87.0% |
| 275 | MG518355 | Tetranychus pueraricola haplotype TP3 mitochondrion, complete genome | 681 | 100.0% | 644.728 | 4.62e-180 | 86.9% |
| 276 | MG518356 | Tetranychus pueraricola haplotype TP1. mitochondrion, complete genome | 681 | 100.0% | 644.728 | 4.62e-180 | 86.9% |
| 277 | NC_024680 | Tetranychus pueraricola mitochondrion, complete genome | 681 | 100.0% | 644.728 | 4.62e-180 | 86.9% |
| 278 | KC136127 | Tetranychus kanzawai voucher 20090515-1-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 620.94 | 6.69e-173 | 86.9% |
| 279 | MG312210 | Tetranychus sp. BIOUG07702-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 95.6% | 618.958 | 2.64e-172 | 86.9% |
| 280 | MG313422 | Tetranychus sp. BIOUG07702-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.8% | 595.171 | 3.82e-165 | 86.9% |
| 281 | MG316104 | Tetranychidae sp. BIOUG07702-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.8% | 595.171 | 3.82e-165 | 86.9% |
| 282 | MG313376 | Tetranychidae sp. BIOUG07702-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.8% | 595.171 | 3.82e-165 | 86.9% |
| 283 | KM833190 | Tetranychus sp. BOLD:ACJ9022 voucher BIOUG08282-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.4% | 567.419 | 8.64e-157 | 86.9% |
| 284 | KR102056 | Tetranychus sp. BOLD:ACL8248 voucher BIOUG10452-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 553.543 | 1.30e-152 | 86.9% |
| 285 | MG310382 | Tetranychus urticae voucher BIOUG32652-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 82.7% | 529.756 | 1.88e-145 | 86.9% |
| 286 | OR916021 | Tetranychus urticae strain Broo34 mitochondrion, complete genome | 681 | 100.0% | 636.798 | 1.13e-177 | 86.8% |
| 287 | OR916022 | Tetranychus urticae strain Nasheep mitochondrion, complete genome | 681 | 100.0% | 636.798 | 1.13e-177 | 86.8% |
| 288 | MN417333 | Tetranychus evansi mitochondrion, complete genome | 681 | 100.0% | 636.798 | 1.13e-177 | 86.8% |
| 289 | NC_014399 | Tetranychus cinnabarinus mitochondrion, complete genome | 681 | 100.0% | 636.798 | 1.13e-177 | 86.8% |
| 290 | MG518354 | Tetranychus pueraricola haplotype TP2. mitochondrion, complete genome | 681 | 100.0% | 636.798 | 1.13e-177 | 86.8% |
| 291 | MT814157 | Tetranychus urticae isolate 17MEY12a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 553.543 | 1.30e-152 | 86.8% |
| 292 | OL333562 | Tetranychus urticae isolate Scp-w cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 553.543 | 1.30e-152 | 86.8% |
| 293 | MG320304 | Tetranychus urticae voucher BIOUG31965-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 85.5% | 545.614 | 3.17e-150 | 86.8% |
| 294 | MG310497 | Tetranychus urticae voucher BIOUG31877-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 576 | 84.6% | 539.668 | 1.95e-148 | 86.8% |
| 295 | OQ438704 | Tetranychus truncatus isolate Pusa-9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 601.118 | 6.20e-167 | 86.7% |
| 296 | MG310390 | Tetranychus sp. BIOUG07702-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 91.6% | 579.313 | 2.27e-160 | 86.7% |
| 297 | KM828468 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG08282-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 545.614 | 3.17e-150 | 86.7% |
| 298 | MG314007 | Tetranychus sp. BIOUG07257-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 545.614 | 3.17e-150 | 86.7% |
| 299 | KM840127 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG08282-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 545.614 | 3.17e-150 | 86.7% |
| 300 | MT814079 | Tetranychus urticae isolate 17CAS15 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 581 | 85.3% | 541.65 | 4.94e-149 | 86.7% |
| 301 | MW542508 | Tetranychus urticae strain NEV2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 444 | 65.2% | 414.785 | 7.66e-111 | 86.7% |
| 302 | MW542506 | Tetranychus urticae strain KC cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 444 | 65.2% | 414.785 | 7.66e-111 | 86.7% |
| 303 | MW542507 | Tetranychus urticae strain NEV1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 444 | 65.2% | 414.785 | 7.66e-111 | 86.7% |
| 304 | OR906291 | Tetranychus urticae strain Bram mitochondrion, complete genome | 681 | 100.0% | 628.869 | 2.74e-175 | 86.6% |
| 305 | MG320131 | Tetranychus turkestani voucher BIOUG22881-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 605.082 | 3.97e-168 | 86.6% |
| 306 | MN352015 | Tetranychus sp. BOLD:ADE0656 voucher BIOUG30852-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 94.1% | 591.206 | 5.97e-164 | 86.6% |
| 307 | MN349045 | Tetranychus sp. BOLD:ADE0656 voucher BIOUG30852-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 94.0% | 589.224 | 2.36e-163 | 86.6% |
| 308 | MG320848 | Tetranychus sp. BIOUG01946-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.8% | 579.313 | 2.27e-160 | 86.6% |
| 309 | MT814073 | Tetranychus urticae isolate 15MEY10a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 310 | MT814074 | Tetranychus urticae isolate 15MEY15a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 311 | MT814076 | Tetranychus urticae isolate 16CAS6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 312 | MT814083 | Tetranychus urticae isolate 17MEY10d cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 313 | MT814071 | Tetranychus urticae isolate 15CAS15 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 314 | MT814077 | Tetranychus urticae isolate 16MEY10c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 315 | MT814078 | Tetranychus urticae isolate 16MEY15 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 316 | MT814075 | Tetranychus urticae isolate 16CAS20b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 317 | MT814080 | Tetranychus urticae isolate 17CAS16 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 318 | MT814072 | Tetranychus urticae isolate 15CAS16 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 319 | MT814084 | Tetranychus urticae isolate 17MEY15 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 320 | MT814081 | Tetranychus urticae isolate 17CAS32 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 321 | MT814082 | Tetranychus urticae isolate 17CAS33 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 545.614 | 3.17e-150 | 86.6% |
| 322 | KM834097 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG08287-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 85.5% | 535.703 | 3.05e-147 | 86.6% |
| 323 | MT814061 | Tetranychus urticae isolate 17CAS27 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 581 | 85.3% | 533.721 | 1.20e-146 | 86.6% |
| 324 | MG311328 | Tetranychus sp. BIOUG07257-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 85.2% | 531.739 | 4.76e-146 | 86.6% |
| 325 | MF742975 | Tetranychidae sp. BIOUG20196-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 81.4% | 511.916 | 4.41e-140 | 86.6% |
| 326 | MG518357 | Tetranychus pueraricola haplotype TP5. mitochondrion, complete genome | 681 | 100.0% | 620.94 | 6.69e-173 | 86.5% |
| 327 | KF447573 | Tetranychus urticae strain Santpoort1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 680 | 99.9% | 620.94 | 6.69e-173 | 86.5% |
| 328 | MF152825 | Tetranychus urticae strain RR cytochrome oxidase subunit I gene, partial cds; mitochondrial | 681 | 100.0% | 620.94 | 6.69e-173 | 86.5% |
| 329 | MF152824 | Tetranychus urticae strain SS cytochrome oxidase subunit I gene, partial cds; mitochondrial | 669 | 98.2% | 613.011 | 1.63e-170 | 86.5% |
| 330 | MG313608 | Tetranychus turkestani voucher BIOUG22881-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.4% | 551.561 | 5.13e-152 | 86.5% |
| 331 | MG319769 | Tetranychus turkestani voucher BIOUG22881-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.4% | 551.561 | 5.13e-152 | 86.5% |
| 332 | MT814068 | Tetranychus urticae isolate 17CAS30 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 333 | MT814062 | Tetranychus urticae isolate 15CAS3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 334 | MT814060 | Tetranychus urticae isolate 17CAS21a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 335 | MT814064 | Tetranychus urticae isolate 15CAS7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 336 | MT814067 | Tetranychus urticae isolate 17CAS3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 337 | MT814063 | Tetranychus urticae isolate 15CAS6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 338 | MT814065 | Tetranychus urticae isolate 16CAS20a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 339 | MT814058 | Tetranychus urticae isolate 16CAS3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 340 | MT814069 | Tetranychus urticae isolate 17CAS6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 341 | MT814070 | Tetranychus urticae isolate 17CAS7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 342 | MT814066 | Tetranychus urticae isolate 17CAS29 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 537.685 | 7.72e-148 | 86.5% |
| 343 | KM837246 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG08287-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 578 | 84.9% | 527.774 | 7.43e-145 | 86.5% |
| 344 | KM826880 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG08282-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 578 | 84.9% | 527.774 | 7.43e-145 | 86.5% |
| 345 | MG315085 | Tetranychus sp. BIOUG07257-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 578 | 84.9% | 527.774 | 7.43e-145 | 86.5% |
| 346 | KM834921 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG08282-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 82.7% | 513.898 | 1.12e-140 | 86.5% |
| 347 | MG315579 | Tetranychidae sp. BIOUG07702-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 562 | 82.5% | 511.916 | 4.41e-140 | 86.5% |
| 348 | KM832831 | Tetranychidae sp. BOLD:ACJ0519 voucher BIOUG08287-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 81.4% | 503.987 | 1.08e-137 | 86.5% |
| 349 | MF752043 | Tetranychidae sp. BIOUG20818-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 525 | 77.1% | 478.217 | 6.15e-130 | 86.5% |
| 350 | AJ316598 | Tetranychus urticae partial mitochondrial COI gene for cytochrome oxidase subunit I, strain TuI | 444 | 65.2% | 406.856 | 1.87e-108 | 86.5% |
| 351 | OQ438701 | Tetranychus truncatus isolate Pusa-6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 585.26 | 3.68e-162 | 86.4% |
| 352 | OQ438700 | Tetranychus truncatus isolate Pusa-5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 585.26 | 3.68e-162 | 86.4% |
| 353 | MG320375 | Tetranychus sp. BIOUG01946-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.4% | 543.632 | 1.25e-149 | 86.4% |
| 354 | MG320612 | Tetranychus sp. BIOUG01946-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 601 | 88.3% | 541.65 | 4.94e-149 | 86.4% |
| 355 | MT477910 | Oligonychus tylus voucher UAS-B:2345C cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 548 | 80.5% | 494.076 | 1.04e-134 | 86.4% |
| 356 | NC_010526 | Tetranychus urticae mitochondrion, complete genome | 681 | 100.0% | 613.011 | 1.63e-170 | 86.3% |
| 357 | EU556754 | Tetranychus urticae strain BR-VL mitochondrion, complete genome | 681 | 100.0% | 613.011 | 1.63e-170 | 86.3% |
| 358 | KJ092874 | Tetranychus sp. BOLD:ACB3442 voucher BIOUG03563-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 589.224 | 2.36e-163 | 86.3% |
| 359 | MN349728 | Tetranychus sp. BOLD:ACJ0519 voucher BIOUG30679-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 94.0% | 573.366 | 1.40e-158 | 86.3% |
| 360 | MG313713 | Tetranychus turkestani voucher BIOUG22881-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 94.0% | 573.366 | 1.40e-158 | 86.3% |
| 361 | MN355350 | Tetranychus sp. BOLD:ADD2476 voucher BIOUG30422-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 91.9% | 559.49 | 2.11e-154 | 86.3% |
| 362 | MT814158 | Tetranychus urticae isolate 17MEY14a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 529.756 | 1.88e-145 | 86.3% |
| 363 | MT814159 | Tetranychus urticae isolate 17MEY16b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 529.756 | 1.88e-145 | 86.3% |
| 364 | MG318931 | Tetranychus sp. BIOUG07702-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 83.7% | 511.916 | 4.41e-140 | 86.3% |
| 365 | MG311882 | Tetranychus turkestani voucher BIOUG22881-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 82.7% | 505.969 | 2.72e-138 | 86.3% |
| 366 | KF887952 | Tetranychus urticae strain Algarrobo1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 95.7% | 581.295 | 5.75e-161 | 86.2% |
| 367 | MG320392 | Tetranychus turkestani voucher BIOUG22880-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.0% | 579.313 | 2.27e-160 | 86.2% |
| 368 | MG311516 | Tetranychus urticae voucher BIOUG32652-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 83.3% | 505.969 | 2.72e-138 | 86.2% |
| 369 | MT019792 | Tetranychus evansi isolate CO1_SC_Sample_7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 370 | MT019778 | Tetranychus evansi isolate CO1_JT_Sample_10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 371 | MT019694 | Tetranychus evansi isolate CO1_Algarrobo-1_Sample_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 372 | MT019779 | Tetranychus evansi isolate CO1_Sde_Eliyahu-1_Sample_12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 373 | MT019781 | Tetranychus evansi isolate CO1_Sde_Eliyahu-1_Sample_15 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 374 | FJ440677 | Tetranychus evansi strain TW cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 375 | MT019732 | Tetranychus evansi isolate CO1_SC_Sample_11 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 376 | MT019789 | Tetranychus evansi isolate CO1_Sde_Eliyahu-1_Sample_16 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 377 | GU145106 | Tetranychus evansi strain Uruguaiana cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 378 | MT019707 | Tetranychus evansi isolate CO1_Chiyoda-1_Sample_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 396.945 | 1.80e-105 | 86.2% |
| 379 | OQ438703 | Tetranychus truncatus isolate Pusa-8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 569.402 | 2.19e-157 | 86.1% |
| 380 | OQ438699 | Tetranychus truncatus isolate Pusa-4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 569.402 | 2.19e-157 | 86.1% |
| 381 | MT814160 | Tetranychus urticae isolate 16MEY13b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 521.827 | 4.58e-143 | 86.1% |
| 382 | MT814162 | Tetranychus urticae isolate 15MEY14b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 521.827 | 4.58e-143 | 86.1% |
| 383 | MT814167 | Tetranychus urticae isolate 17MEY5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 521.827 | 4.58e-143 | 86.1% |
| 384 | MT814168 | Tetranychus urticae isolate 17MEY7c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 521.827 | 4.58e-143 | 86.1% |
| 385 | MT814164 | Tetranychus urticae isolate 16MEY3d cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 521.827 | 4.58e-143 | 86.1% |
| 386 | MZ674495 | Tetranychus macfarlanei voucher UAS-B:250721 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 577 | 84.7% | 503.987 | 1.08e-137 | 86.1% |
| 387 | KM824019 | Tetranychus sp. BOLD:ACJ9022 voucher BIOUG08504-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 81.4% | 492.093 | 4.09e-134 | 86.1% |
| 388 | PP060370 | Tetranychus evansi isolate NLT-E cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 445 | 65.3% | 392.98 | 2.81e-104 | 86.1% |
| 389 | NC_024677 | Tetranychus ludeni mitochondrion, complete genome | 681 | 100.0% | 597.153 | 9.68e-166 | 86.0% |
| 390 | KF447572 | Tetranychus urticae strain Houten1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 680 | 99.9% | 597.153 | 9.68e-166 | 86.0% |
| 391 | MZ151410 | Tetranychus ludeni voucher JKI-GFE-21-002-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 96.3% | 573.366 | 1.40e-158 | 86.0% |
| 392 | KX281698 | Tetranychus ludeni voucher ww26550 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 573.366 | 1.40e-158 | 86.0% |
| 393 | KX281710 | Tetranychus ludeni voucher ww26537 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 573.366 | 1.40e-158 | 86.0% |
| 394 | KX281694 | Tetranychus ludeni voucher ww26548 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 573.366 | 1.40e-158 | 86.0% |
| 395 | KX281706 | Tetranychus ludeni voucher ww26552 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 573.366 | 1.40e-158 | 86.0% |
| 396 | KX281712 | Tetranychus ludeni voucher ww26538 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 573.366 | 1.40e-158 | 86.0% |
| 397 | KX281707 | Tetranychus ludeni voucher ww26535 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 573.366 | 1.40e-158 | 86.0% |
| 398 | MT814189 | Tetranychus urticae isolate 17MEY13a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 399 | MT814190 | Tetranychus urticae isolate 17MEY14b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 400 | MT814194 | Tetranychus urticae isolate 17MEY1a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 401 | MT814187 | Tetranychus urticae isolate 17MEY11a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 402 | MT814185 | Tetranychus urticae isolate 16MEY7b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 403 | MT814197 | Tetranychus urticae isolate 17MEY6c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 404 | MT814188 | Tetranychus urticae isolate 17MEY12c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 405 | MT814180 | Tetranychus urticae isolate 16MEY13a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 406 | MT814192 | Tetranychus urticae isolate 17MEY17a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 407 | MT814171 | Tetranychus urticae isolate 15MEY12a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 408 | MT814184 | Tetranychus urticae isolate 16MEY6a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 409 | MT814191 | Tetranychus urticae isolate 17MEY16a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 410 | MT814199 | Tetranychus urticae isolate 15MEY11b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 411 | MT814183 | Tetranychus urticae isolate 16MEY4b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 412 | MT814172 | Tetranychus urticae isolate 15MEY14a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 413 | MT814173 | Tetranychus urticae isolate 15MEY16a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 414 | MT814181 | Tetranychus urticae isolate 16MEY14b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 415 | MT814170 | Tetranychus urticae isolate 15MEY6a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 416 | MT814186 | Tetranychus urticae isolate 17MEY10b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 417 | MT814169 | Tetranychus urticae isolate 15MEY11a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 418 | MT814202 | Tetranychus urticae isolate 17MEY9a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 419 | MT814176 | Tetranychus urticae isolate 15MEY3a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 420 | MT814198 | Tetranychus urticae isolate 17MEY7b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 421 | MT814175 | Tetranychus urticae isolate 15MEY2a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 422 | MT814174 | Tetranychus urticae isolate 15MEY1b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 591 | 86.8% | 513.898 | 1.12e-140 | 86.0% |
| 423 | MG314954 | Tetranychus sp. BIOUG07257-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 83.0% | 496.058 | 2.62e-135 | 86.0% |
| 424 | MG320973 | Tetranychidae sp. BIOUG22881-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 559 | 82.1% | 490.111 | 1.62e-133 | 86.0% |
| 425 | HM565907 | Tetranychus urticae voucher 13_1 Greece cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 486 | 71.4% | 426.679 | 2.01e-114 | 86.0% |
| 426 | MT019801 | Tetranychus evansi isolate CO1_Carangola-1_Sample_8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 469 | 68.9% | 408.838 | 4.72e-109 | 86.0% |
| 427 | AF131106 | Tetranychus cinnabarinus cytochrome oxidase subunit I gene, partial cds; mitochondrial gene for mitochondrial product | 463 | 68.0% | 404.874 | 7.38e-108 | 86.0% |
| 428 | GU145111 | Tetranychus evansi strain North East Brazil cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 463 | 68.0% | 404.874 | 7.38e-108 | 86.0% |
| 429 | MT019811 | Tetranychus evansi isolate CO1_Carangola-1_Sample_10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 404.874 | 7.38e-108 | 86.0% |
| 430 | MT019800 | Tetranychus evansi isolate CO1_Carangola-1_Sample_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 404.874 | 7.38e-108 | 86.0% |
| 431 | FJ440676 | Tetranychus evansi strain FT cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 463 | 68.0% | 404.874 | 7.38e-108 | 86.0% |
| 432 | MT019813 | Tetranychus evansi isolate CO1_Vicosa-1_Sample_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 404.874 | 7.38e-108 | 86.0% |
| 433 | MT019812 | Tetranychus evansi isolate CO1_Carangola-1_Sample_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 462 | 67.8% | 402.891 | 2.91e-107 | 86.0% |
| 434 | KX281701 | Tetranychus evansi voucher ww26529 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 435 | KX281715 | Tetranychus evansi voucher ww26533 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 436 | KX281705 | Tetranychus evansi voucher ww26541 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 437 | KX281700 | Tetranychus evansi voucher ww26540 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 438 | KX281696 | Tetranychus evansi voucher ww26528 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 439 | KX281709 | Tetranychus evansi voucher ww26524 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 440 | KX281714 | Tetranychus evansi voucher ww26551 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 441 | KX281697 | Tetranychus evansi voucher ww26525 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 442 | KX281713 | Tetranychus evansi voucher ww26542 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 443 | KX281711 | Tetranychus evansi voucher ww26521 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 444 | KX281716 | Tetranychus evansi voucher ww26523 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 435 | 63.9% | 381.087 | 1.07e-100 | 86.0% |
| 445 | KM833924 | Tetranychus sp. BOLD:ACJ4622 voucher BIOUG07436-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.4% | 519.845 | 1.81e-142 | 85.9% |
| 446 | KM829650 | Tetranychus sp. BOLD:ACJ4622 voucher BIOUG08287-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 505.969 | 2.72e-138 | 85.9% |
| 447 | MT019790 | Tetranychus evansi isolate CO1_SV_Sample_12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 448 | MT019774 | Tetranychus evansi isolate CO1_SV_Sample_10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 449 | MT019766 | Tetranychus evansi isolate CO1_KM_Sample_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 450 | MT019785 | Tetranychus evansi isolate CO1_KM_Sample_14 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 451 | MT019791 | Tetranychus evansi isolate CO1_SV_Sample_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 452 | MT019782 | Tetranychus evansi isolate CO1_KM_Sample_10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 453 | GU145109 | Tetranychus evansi strain Reunion Is cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 454 | MT019784 | Tetranychus evansi isolate CO1_KM_Sample_12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 455 | MT019786 | Tetranychus evansi isolate CO1_KM_Sample_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 456 | MT019797 | Tetranychus evansi isolate CO1_SV_Sample_9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 457 | GU145108 | Tetranychus evansi strain Valencia cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 458 | MT019783 | Tetranychus evansi isolate CO1_KM_Sample_11 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 459 | FJ440678 | Tetranychus evansi strain KM cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 447 | 65.6% | 389.016 | 4.38e-103 | 85.9% |
| 460 | KJ166102 | Tetranychus sp. BOLD:ACB3442 voucher BIOUG03677-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 571.384 | 5.54e-158 | 85.8% |
| 461 | MN913382 | Mononychellus caribbeanae voucher 1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 86.6% | 503.987 | 1.08e-137 | 85.8% |
| 462 | MT019814 | Tetranychus evansi isolate CO1_Carangola-1_Sample_11 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 396.945 | 1.80e-105 | 85.8% |
| 463 | MT019820 | Tetranychus evansi isolate CO1_Carangola-1_Sample_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 463 | 68.0% | 396.945 | 1.80e-105 | 85.8% |
| 464 | GU145110 | Tetranychus evansi strain Venancio Aires cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 463 | 68.0% | 396.945 | 1.80e-105 | 85.8% |
| 465 | FJ440675 | Tetranychus evansi strain BP cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 463 | 68.0% | 396.945 | 1.80e-105 | 85.8% |
| 466 | MF745860 | Tetranychus sp. BIOUG16811-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 557.508 | 8.32e-154 | 85.7% |
| 467 | MN356619 | Tetranychidae sp. BOLD:ADI4824 voucher BIOUG35816-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 96.5% | 551.561 | 5.13e-152 | 85.7% |
| 468 | OQ438705 | Tetranychus truncatus isolate Pusa-10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 545.614 | 3.17e-150 | 85.7% |
| 469 | JX075252 | Tetranychus ludeni cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 500.022 | 1.68e-136 | 85.7% |
| 470 | KM824700 | Tetranychus sp. BOLD:ACJ4622 voucher BIOUG08282-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 86.2% | 498.04 | 6.64e-136 | 85.7% |
| 471 | MF751314 | Tetranychus sp. BIOUG16811-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 525 | 77.1% | 446.501 | 2.17e-120 | 85.7% |
| 472 | MW898015 | Oligonychus grypus voucher UAS-B:2847(201227-S) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 524 | 76.9% | 446.501 | 2.17e-120 | 85.7% |
| 473 | GU145107 | Tetranychus evansi strain San Miguel de Tucuman cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 447 | 65.6% | 381.087 | 1.07e-100 | 85.7% |
| 474 | MN363677 | Tetranychidae sp. BOLD:ACI5303 voucher BIOUG33503-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 96.5% | 551.561 | 5.13e-152 | 85.6% |
| 475 | MF749512 | Tetranychus sp. BIOUG16811-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.8% | 533.721 | 1.20e-146 | 85.6% |
| 476 | OQ438697 | Tetranychus truncatus isolate Pusa-2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 537.685 | 7.72e-148 | 85.5% |
| 477 | MG319878 | Tetranychus sp. BIOUG01946-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 476 | 69.9% | 404.874 | 7.38e-108 | 85.5% |
| 478 | MT019794 | Tetranychus evansi isolate CO1_SV_Sample_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 428 | 62.8% | 359.282 | 3.91e-94 | 85.5% |
| 479 | OQ438698 | Tetranychus ludeni isolate Pusa-3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 646 | 94.9% | 537.685 | 7.72e-148 | 85.4% |
| 480 | KM833127 | Tetranychus sp. BOLD:ACJ4622 voucher BIOUG07436-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 81.4% | 456.413 | 2.25e-123 | 85.4% |
| 481 | MT019765 | Tetranychus evansi isolate CO1_KM_Sample_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 485 | 71.2% | 400.909 | 1.15e-106 | 85.4% |
| 482 | MN338390 | Tetranychidae sp. LD01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 96.5% | 527.774 | 7.43e-145 | 85.1% |
| 483 | KM833793 | Tetranychus sp. BOLD:ACJ4622 voucher BIOUG06881-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 83.0% | 454.43 | 8.91e-123 | 85.1% |
| 484 | OP518478 | Eotetranychus kankitus voucher GX24-4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 96.5% | 511.916 | 4.41e-140 | 84.8% |
| 485 | OP518476 | Eotetranychus kankitus voucher GQ17-5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 96.5% | 511.916 | 4.41e-140 | 84.8% |
| 486 | OP518477 | Eotetranychus kankitus voucher GX24-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 96.5% | 511.916 | 4.41e-140 | 84.8% |
| 487 | OP518479 | Eotetranychus kankitus voucher GX24-5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 96.5% | 511.916 | 4.41e-140 | 84.8% |
| 488 | NC_014347 | Panonychus citri mitochondrion, complete genome | 681 | 100.0% | 517.863 | 7.16e-142 | 84.6% |
| 489 | HM189212 | Panonychus citri mitochondrion, complete genome | 681 | 100.0% | 509.934 | 1.74e-139 | 84.5% |
| 490 | KM826643 | Oligonychus sp. BOLD:ACF7822 voucher BIOUG03963-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 88.5% | 426.679 | 2.01e-114 | 84.1% |
| 491 | KF011460 | Oligonychus punicae isolate 8V4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 680 | 99.9% | 478.217 | 6.15e-130 | 83.9% |
| 492 | KF011453 | Oligonychus punicae isolate 8M7 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 680 | 99.9% | 478.217 | 6.15e-130 | 83.9% |
| 493 | KF011461 | Oligonychus punicae isolate 8V7 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 680 | 99.9% | 478.217 | 6.15e-130 | 83.9% |
| 494 | KF011456 | Oligonychus punicae isolate 8V8 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 680 | 99.9% | 478.217 | 6.15e-130 | 83.9% |
| 495 | KF011464 | Oligonychus punicae isolate 8D6 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 680 | 99.9% | 470.288 | 1.50e-127 | 83.8% |
| 496 | KF011455 | Oligonychus punicae isolate 8M2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 614 | 90.2% | 408.838 | 4.72e-109 | 83.5% |
| 497 | KM827653 | Tetranychidae sp. BOLD:ACI5294 voucher BIOUG06962-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 599 | 88.0% | 394.962 | 7.10e-105 | 83.5% |
| 498 | MG312988 | Tetranychidae sp. BIOUG25555-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 96.5% | 432.625 | 3.26e-116 | 83.3% |
| 499 | KR069145 | Tetranychidae sp. BOLD:AAM8023 voucher DPMIT-38-33 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 383.069 | 2.70e-101 | 82.6% |
| 500 | KP979272 | Tetranychidae sp. BOLD:AAM8023 voucher DPMIT-38-32 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.3% | 375.14 | 6.59e-99 | 82.4% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Tetranychus | genus | Tetranychus | Tetranychus marianae | MW326470 | 0.989 |
Database coverage of Taxon of Interest TetranychusThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Tetranychus
Flag 5.1A:
The reference data supports this taxon well
696 records
There are 696 sequences in the reference database for Tetranychus at the given locus COI.
Global occurrence records for Tetranychus.
Database coverage of species in genus Tetranychus
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Tetranychus that occur in country of origin Australia
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI |
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Candidates
Independent sources
Flag 4B:
Reference sequence sources lack diversity and may therefore be unreliable
Reasoning: Matching sequence records for this species have only 1-5 independent sources
(found 2 sources)
2 Independent Sources
The matching reference sequences for this species have been annotated by 2 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| MW326470 | False |
Sharkey,E.R. Bolton,S.J. Moore,M.R. McVay,J.D. Beaulieu,F. |
Morphological and molecular data reveal the conspecificity of Tetranychus gloveri and Tetranychus okinawanus (Acari: Trombidiformes: Tetranychidae) | Unpublished |
| MW326470 | False |
Moore,M.R. Roberts,C.G. Combee,L.A. Sharkey,E.R. |
Direct Submission | Submitted (02-DEC-2020) Division of Plant Industry, Florida Department of Agriculture and Consumer Services, 1911 SW 34th St, Gainesville, FL 32608, USA |
| MW326471 | False |
Sharkey,E.R. Bolton,S.J. Moore,M.R. McVay,J.D. Beaulieu,F. |
Morphological and molecular data reveal the conspecificity of Tetranychus gloveri and Tetranychus okinawanus (Acari: Trombidiformes: Tetranychidae) | Unpublished |
| MW326471 | False |
Moore,M.R. Roberts,C.G. Combee,L.A. Sharkey,E.R. |
Direct Submission | Submitted (02-DEC-2020) Division of Plant Industry, Florida Department of Agriculture and Consumer Services, 1911 SW 34th St, Gainesville, FL 32608, USA |
| MW326472 | False |
Sharkey,E.R. Bolton,S.J. Moore,M.R. McVay,J.D. Beaulieu,F. |
Morphological and molecular data reveal the conspecificity of Tetranychus gloveri and Tetranychus okinawanus (Acari: Trombidiformes: Tetranychidae) | Unpublished |
| MW326472 | False |
Moore,M.R. Roberts,C.G. Combee,L.A. Sharkey,E.R. |
Direct Submission | Submitted (02-DEC-2020) Division of Plant Industry, Florida Department of Agriculture and Consumer Services, 1911 SW 34th St, Gainesville, FL 32608, USA |
| MW326473 | False |
Sharkey,E.R. Bolton,S.J. Moore,M.R. McVay,J.D. Beaulieu,F. |
Morphological and molecular data reveal the conspecificity of Tetranychus gloveri and Tetranychus okinawanus (Acari: Trombidiformes: Tetranychidae) | Unpublished |
| MW326473 | False |
Moore,M.R. Roberts,C.G. Combee,L.A. Sharkey,E.R. |
Direct Submission | Submitted (02-DEC-2020) Division of Plant Industry, Florida Department of Agriculture and Consumer Services, 1911 SW 34th St, Gainesville, FL 32608, USA |
| MW672202 | False |
Sharkey,E.R. Moore,M.R. Bolton,S.J. Beaulieu,F. |
Morphological and molecular data reveal the conspecificity of Tetranychus gloveri and Tetranychus okinawanus (Acari: Trombidiformes: Tetranychidae) | Unpublished |
| MW672202 | False |
Moore,M.R. Roberts,C.G. Combee,L.A. Sharkey,E.R. |
Direct Submission | Submitted (26-FEB-2021) Division of Plant Industry, Florida Department of Agriculture and Consumer Services, 1911 SW 34th St, Gainesville, FL 32608, USA |
| Show Hide 8 more publications... | ||||
Source 2
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| OP703558 | False |
Bhaskar,H. Mohan S,M. Sajimon,B. |
Direct Submission | Submitted (23-OCT-2022) Agricultural Entomology, Kerala Agricultural University, Vellanikkara, Thrissur, Kerala 680656, India |
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |